Question

The MYH16 gene, a jaw-muscle specific gene in the great apes is sequenced and compared between humans, chimps and gorillas. Assume that I have provided you with a region of the coding strand of this sequence in each species.

HUMAN…. ATGATTAACGGGAATGGTAGGTAGAT

CHIMP…   ATGATTAACGGACGAATGGTAGGTAG

GORILLA...ATGATTAACGGACGAATGGTAGGTAG

Identify the differences (if any) between the sequences and then discuss what effect this is likely to have on the final function of

the protein. Explain what you think is most likely to have occurred at this gene.

Answer 1

In the below figure we can see that there is a deletion mutation of A and C base pair at 12 and 13 position in case of human MHY16 gene.

MHY16 gene encodes Myosin heavy chain 16 which is a muscle protein in mammals. This protein is important for muscle contraction. In non human primates, MHY16 is functional and they have powerful jaw muscle as seen in Chimp, Gorilla etc. In human this gene has a mutation (deletion of A anc C base in 12 and 13 position as shwn in below figure)which cause the protein not to function.