Question

5. In gel A, if all DNA samples from people have 2 alleles of each gene...

5. In gel A, if all DNA samples from people have 2 alleles of each gene (therefore 2 bands in each gel lane), what is one rational for why only one band is visible in lane 3?

Science   Biology   
0 0
Add a commentTranscribed image text
Next >

Homework Answers

Answer #1

In case of heterozygous loci, there will be two different alleles coding for the protein. Since the alleles may differ in their lengths, gel electrophoresis will show 2 different bands in case of heterozygous locus. If the locos is homozygous (dominant or recessive) both the alleles will be identical, so gel will show both the allleles at the same location. Thus,

Homozygous -> same alleles -> same length -> one band.

Heterozygous -> different alleles -> different length -> two bands.

The lane 3 contains DNA from homozygous locus.

0 0
Know the answer?
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Log In

Sign Up

Not the answer you're looking for?
Ask your own homework help question
Similar Questions
1. After re-do your culture, you now have to amplify your report gene so that you...
1. After re-do your culture, you now have to amplify your report gene so that you have enough DNA to continue your experiment. You decided to alter the concentration of template DNA strand as a testing condition. After PCR, you decided to run a gel electrophoresis to see the results of your testing condition. You loaded your ladder and enough DNA to give you bands that are bright enough to visualize. However, after you run the gel and take it...
If you do a PCR reaction with DNA from a person who is heterozygous for a...
If you do a PCR reaction with DNA from a person who is heterozygous for a SNP in the gene you are amplifying and you have a restriction enzyme that will recognize and cut only the one of the two allleles, how many bands will you see if you run the restriction digest out on an agarose gel?
Electrophoresis Virtual Lab (11 Pts) 1. DNA will move toward which color electrode? What electrical charge...
Electrophoresis Virtual Lab (11 Pts) 1. DNA will move toward which color electrode? What electrical charge does this pole have? What about the structure of DNA, specifically, is responsible for this behavior? (3) 3. What is the purpose of a DNA standard in your gel? (2) 5. Let’s analyze the following scenarios: A. gels were prepared and the DNA samples, along with a DNA standard were placed in the wells. After an hour running the gel, the samples seem to...
1.A technique used to identify RNA after gel electrophoresis and which employs ssDNA in the detection...
1.A technique used to identify RNA after gel electrophoresis and which employs ssDNA in the detection process is the _____ blot. Select one: a. Northern b. Western c. Northeastern d. Southern e. Southwestern 2. DNA sequencing by controlled termination of replication is called the _____ method. Select one: a. Sanger b. E. coli c. Restriction enzymes d. DNA Microarray e. Ligase f. Polymerase Chain Reaction g. Footprint h. Reverse Trancriptase i. Vector j. Expression k. Fluorescent l. cDNA 3. How...
To save money, lab usually merges blood samples for test. Samples from multiple people will be...
To save money, lab usually merges blood samples for test. Samples from multiple people will be tested only once, if the result is negative (i.e. no virus, every criterion is in the normal range, etc.), then all these people tested are healthy. If the result is positive (at least one person from this batch whose blood sample is abnormal), then these samples are tested one-by-one. Suppose all samples are taken independently. If the probability that for a person to get...
QUESTION 1 :The alleles of a particular gene segregate independently into individual gametes (sex cells) during...
QUESTION 1 :The alleles of a particular gene segregate independently into individual gametes (sex cells) during meiosis. True or False QUESTION 2:The DNA sequence of a gene is a phenotype. True or False QUESTION 3:Two diploid individuals, one homozygous and the other heterozygous at a particular gene, make babies. Which of the following statements about the offspring genotype is correct? (Hint: draw Punnett squares) A. All offspring are heterozygotes B. All offspring are homozygotes C. 1/2 of the offspring are...
A neurological disease, spinocerebellar ataxia Type 1, is caused by a dominant allele of an autosomal...
A neurological disease, spinocerebellar ataxia Type 1, is caused by a dominant allele of an autosomal polyQ-type triplet repeat gene called SCA1. Normal SCA1 alleles contain between 6-35 CAG repeats; pre-mutation alleles contain between 36-48 CAG repeats; and disease alleles contain between 49-88 CAG repeats. To determine whether or not you have a SCA1 pre-mutation allele, you prepare genomic DNA from some of your cheek cells and amplify the smallest possible region of your genome that contains the SCA1 gene...
What are some effects of gene therapy? Select all that apply. 1. Cut faulty DNA out...
What are some effects of gene therapy? Select all that apply. 1. Cut faulty DNA out of cells 2. Insert “healthy” genes into cells 3. Silence genes that cause diseases 4. Make possible the transmission of healthy genes to offspring 5. Introduce DNA from a different species into human cells 6. Potentially enhance performance or appearance
Lab 9 – Molecular Biology In this lab, you will prepare an agarose gel and use...
Lab 9 – Molecular Biology In this lab, you will prepare an agarose gel and use gel electrophoresis to compare the size of 2 dye molecules Methyl orange and Ponceau G. You will also analyze an “unknown” sample that contains a mixture of two dyes. Dye molecules with lower molecular weight or greater electrical charge will migrate faster through the gel, than dye molecules with greater molecular weights or lesser electrical charge. Materials: Mini gel electrophoresis chamber 6 Tooth comb...
Question 1: Explain what differential gene expression is. Question 2: Examine the following DNA template sequence...
Question 1: Explain what differential gene expression is. Question 2: Examine the following DNA template sequence from a eukaryotic gene, transcription starts with and includes the bold A, the bold sequence (CGTGTCCC) is an intron. 3' CTCCGATATATAAAGGGGTCAGTCTACCGCCTCACGTGTCCCTGCGGGTCACAATT5' Write out the mature mRNA sequence, include an explanation of each modification you made. (hint there are three modifications you have to make).
ADVERTISEMENT
Need Online Homework Help?

Get Answers For Free
Most questions answered within 1 hours.

Ask a Question
ADVERTISEMENT