Question

The three main functional segments of a gene are: The three main functional segments of a...

The three main functional segments of a gene are:

The three main functional segments of a mRNA are:

The RNA coding region is delimited by:

The protein coding region is delimited by:

The promoter is recognized and bound by:

The Shine-Dalgarno sequence is recognized and bound by:

Homework Answers

Answer #1

1) three main functional segments of gene are

--Promoter- place where RNA polymerase binds and start transcription

--ORF , part of gene having information to code protein

--Terminator , here transcription process terminate

2) part of mRNA are

5' cap

3' tail - both involve in stability of mRNA as well as in efficient translation

Coding sequence- its has information in form of codon which code for protein

3) RNA coding region is delimited by termination sequence prsent on DNA

4,).protein coding region I'd delimited by stop codon present on mRNA.

5) promoter is recognized by group of transcription factor . Which ultimately help loading of RNA polymerase on promoter.

6) shine dalgrano sequence is present on 5' end of prokaryotic mRNA . This is recognize by 3' tRNA sequence of small subunit of ribosome. Thus placing mRNA in such a way that initaion codon will present at Psite .

Know the answer?
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for?
Ask your own homework help question
Similar Questions
The transcription of a gene involves copying DNA nucleotides from DNA into a sequence of RNA...
The transcription of a gene involves copying DNA nucleotides from DNA into a sequence of RNA nucleotides. Many regulatory factors can help facilitate the transcription processes. One region that affects transcription is the terminator region, which is located on mRNA, downstream of the coding segment on DNA, in the 5' end of the gene on DNA, downstream of the coding segment on mRNA at the 5' end on DNA, within the coding region
Gene expression is complex, requiring many macromolecules and events. This means....lots of vocabulary terms!!! Complete this...
Gene expression is complex, requiring many macromolecules and events. This means....lots of vocabulary terms!!! Complete this matching to show me your mastery of the language. You may want to read the introduction to Lab 15: Gene Expression. molecule that serves as a template for mRNA synthesis name of the process my which RNA is made name of the enzyme that makes RNA direction of RNA synthesis where transcription occurs in prokaryots where transcription happens in eukaryots where RNA polymerase binds...
5. Both epigenetic and genetics can affect gene expression. Below are a few situations affecting Protein...
5. Both epigenetic and genetics can affect gene expression. Below are a few situations affecting Protein X. Please describe for each situation if: A) protein X will be more or less transcribed (or no change), AND B) if this is due to genetic or epigenetic changes. A. Mutation in Protein D so it can no longer target Protein X for deacetylation B. Mutation of the consensus sequence in the promoter of Protein X, resulting in increased association with RNA polymerase...
(2) Below is the entire transcribed RNA sequence of a prokaryotic gene. 5 GCAUAGCAAAUGAGCAUCAUGUGUCAAUGAGGCGAUG 3 (a)...
(2) Below is the entire transcribed RNA sequence of a prokaryotic gene. 5 GCAUAGCAAAUGAGCAUCAUGUGUCAAUGAGGCGAUG 3 (a) Find the protein-coding sequence and provide the amino acid sequence of the encoded protein (b) Which amino acid is at the C-terminus of this peptide?
part 8 Which statement is TRUE about genes? A. promoter marks the end of a gene...
part 8 Which statement is TRUE about genes? A. promoter marks the end of a gene B. genes are located on chromosomes C. genes can function as enzymes D. all parts of a gene is copied RNA One of the reasons why a cell would activate a gene only if its product is required, is; A. to prevent telomere shortening B. to minimize mutations C. for fast response D. to conserve energy Most point mutations that could cause genetic disorders...
Below is the initial part of the gene sequence for  Glut1 as reported in Flybase. It includes...
Below is the initial part of the gene sequence for  Glut1 as reported in Flybase. It includes the 3' untranslated sequence and the first part of the translated sequence. The promoter for this gene is TATAT. Transcription begins with the third base after the promoter. For each answer portion, in your response, write each one starting on a new line and please write A, B, C, etc. as you go. A)   Transcribe and B). translate this sequence into its final peptide...
Molecular Biology and Biochemistry Which of the following enzymatic reaction requires ATP? Conversion of malate to...
Molecular Biology and Biochemistry Which of the following enzymatic reaction requires ATP? Conversion of malate to pyruvate by malic enzyme β-oxidation in mitochondrion matrix Conversion of glyceraldehyde 3-phosphate to 1,3-bisphosphoglyceraldehyde Conversion of glucose 6-phosphate to ribulose 5-phosphate Synthesis of malonyl CoA from acetyl CoA Paracrine signaling is characterized by ligands that are __________. produced by the cell itself secreted by neighboring cells secreted by distant cells able to increase the membrane potential neurotransmitter from a neuron to the target cell...
A coworker supplies you with a PCR product of a gene that encodes a protein your...
A coworker supplies you with a PCR product of a gene that encodes a protein your company wants to overproduce. You are told the DNA has ONLY the coding sequence of the gene. You must be sure the plasmid you choose to ligate this fragment into has an appropriately placed Question 5 options: A) Antibiotic resistance gene B) Promoter C) Ribosome binding site D) B and C E) All of the above
QUESTION 3 In regards to transcriptional gene control, a promoter region would be considered a ________....
QUESTION 3 In regards to transcriptional gene control, a promoter region would be considered a ________. cis-acting element repressor exon trans-acting element QUESTION 4 A contig is formed by ___________. studying protein/DNA interactions sequencing exons overlapping DNA fragments translation of mRNA
Introns are known to contain stop codons (UAA, UGA, or UAG), yet these codons do not...
Introns are known to contain stop codons (UAA, UGA, or UAG), yet these codons do not interrupt the coding of a particular protein. Why? a. More than one stop codon is needed to stop transcription. b. Exons are spliced out of mRNA before translation. c. These triplets do not cause termination in gene expression. d. Stop codons are only required for termination of mRNA synthesis. e. Introns are removed from mRNA before translation A(n) _____ is located upstream of a...