Question

Given the Normal DNA Sequence: 5’ –ATG ATC AGA CTA GCT CAC TCG GGA GTG TGA…...

Given the Normal DNA Sequence: 5’ –ATG ATC AGA CTA GCT CAC TCG GGA GTG TGA… 3’

Determine what type of mutation occurred in the following mutant DNA.

Mutant II: 5’ –ATG ATC AGA CTA GCT CGC TCG GGA GTG TGA… 3’

a. At what codon number did mutation occurred?

b. Identify the type of substitution point mutation happened

c. What is the resulting amino acid of the codon that was mutated?

d. What is the consequence of that mutation?

Homework Answers

Answer #1

Ans- a At the 6th position, means at the 6 th codon from 5' side the mutation has occurred.

Ans-b The type of substitution point mutation is known as missense mutation.

Ans- c mutated codon- C​​​​​​G​​​​​C

So on mRna , the sequence will be - G​​​​​​C​​​​​G

The resulting amino acid is Alanine.

Ans- d The consequence of this mutation is that a different amino acid is produced instead of right one. The protein that is being produced will alter the whole sequence and different protein will be produced.

If you like my answer please upvote.

Know the answer?
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for?
Ask your own homework help question
Similar Questions
Provide the correct mRNA sequence for the following DNA sequence, and then translate this into the...
Provide the correct mRNA sequence for the following DNA sequence, and then translate this into the proper amino acid sequence for the protein the gene would encode: 5′ ATG GAA CGC CTT TAC ATC GTG TGG CAT TAT AGC CAA CGC GTT TAA 3′ Coding 3′ TAC CTT GCG GAA ATG TAG CAC ACC GTA ATA TCG GTT GCG CAA ATT 5′
Transcribe and translate the normal sequence and the mutated sequence. Identify what type of DNA mutation...
Transcribe and translate the normal sequence and the mutated sequence. Identify what type of DNA mutation occurred. (insertion, deletion, or substitution) Identify what type of protein change resulted. (frameshift, missense, nonsense, or silent) normal sequence- 3' TAC GGA GCA GGG CCA AAA AAC TGT TTT ACT 5´ mutated sequence- 3´ TAC GGA GCA GGG CCA CCA AAC TGT TTT ACT 5´
5’…TAC ACC GAT GGA TAA GTC…3’ DNA Coding strand 3’…ATG TGG CTA CCT ATT CAG…5’ DNA...
5’…TAC ACC GAT GGA TAA GTC…3’ DNA Coding strand 3’…ATG TGG CTA CCT ATT CAG…5’ DNA template strand Use the information above to answer the following questions. Write the sequences of the two double-stranded daughter DNAs which will be replicated from the sequence above. Indicate which sequences are directly from the parent. Show accurate direction of each sequence. 0.5 points Write the sequence of the mRNA strand that will be transcribed from the above DNA sequence. Show accurate direction of...
5’…TAC ACC GAT GGA TAA GTC…3’ DNA Coding strand 3’…ATG TGG CTA CCT ATT CAG…5’ DNA...
5’…TAC ACC GAT GGA TAA GTC…3’ DNA Coding strand 3’…ATG TGG CTA CCT ATT CAG…5’ DNA template strand Use the information above to answer the following questions. Write the sequences of the two double-stranded daughter DNAs which will be replicated from the sequence above. Indicate which sequences are directly from the parent. Show accurate direction of each sequence. 0.5 points Write the sequence of the mRNA strand that will be transcribed from the above DNA sequence. Show accurate direction of...
5’…TAC ACC GAT GGA TAA GTC…3’ DNA Coding strand 3’…ATG TGG CTA CCT ATT CAG…5’ DNA...
5’…TAC ACC GAT GGA TAA GTC…3’ DNA Coding strand 3’…ATG TGG CTA CCT ATT CAG…5’ DNA template strand Use the information above to answer the following questions. Write the sequences of the two double-stranded daughter DNAs which will be replicated from the sequence above. Indicate which sequences are directly from the parent. Show accurate direction of each sequence. 0.5 points Write the sequence of the mRNA strand that will be transcribed from the above DNA sequence. Show accurate direction of...
Transcribe and translate the normal sequence and the mutated sequence. Identify what type of DNA mutation...
Transcribe and translate the normal sequence and the mutated sequence. Identify what type of DNA mutation occurred. (insertion, deletion, or substitution) Identify what type of protein change resulted. (frameshift, missense, nonsense, or silent) Normal Sequence 3’ TACCTTCACCGCAGGGTAGCTTTTATTTAA 5’ Mutated sequence 3’ TACCTTCACCGCAGGTAGCTTTTATTTAA 5’
The top on is the normal DNA and the corresponding mRNA sequence. The bottom is the...
The top on is the normal DNA and the corresponding mRNA sequence. The bottom is the DNA and mRNA sequence after a mutation. Answer the following questions: NORMAL: Template DNA 5' - CA TAC GTA TTG CAG ATT - 3' mRNA 5' - __________________________________ MUTATED: Template DNA 5' - CA AC GTA ATT GCA GAT T - 3' mRNA 5' - _________________________________ (a) What is the amino acid sequence for the normal protein? (b) What is the amino acid sequence...
Use the information above to answer the following questions. 5’…TAC ACC GAT GGA TAA GTC…3’ DNA...
Use the information above to answer the following questions. 5’…TAC ACC GAT GGA TAA GTC…3’ DNA Coding strand 3’…ATG TGG CTA CCT ATT CAG…5’ DNA template strand ONLY answer E and F please!! The rest is for reference!! A. Write the sequences of the two double-stranded daughter DNAs which will be replicated from the sequence above. Indicate which sequences are directly from the parent. Show accurate direction of each sequence. 0.5 points B. Write the sequence of the mRNA strand...
5’ – A T G G G A G T A A C A G A...
5’ – A T G G G A G T A A C A G A A T T T G G A T C A T T A T A A – 3’ Assume this is occurring in a bacterium, note the coding strand of DNA above. Now the 13th nucleotide in the DNA coding strand has mutated. The 13th nucleotide is substituted for a thymine. Answer the following questions. - Would there be any change in the amino...
A portion of a protein-coding gene is provided for this question. Given the non-template DNA sequence...
A portion of a protein-coding gene is provided for this question. Given the non-template DNA sequence of 5'-TACTATGCTGAGCATTATTGCTAAGTGATGGCTA-3': a. Write the complementary template DNA sequence in a 5' to 3' direction. b. Write the mRNA sequence that would be transcribed from this segment of DNA in a 5' to 3' direction. c. Starting from the first start codon, write the polypeptide sequence that would be translated from the mRNA sequence. d. Define the following terms in your own words: frameshift...
ADVERTISEMENT
Need Online Homework Help?

Get Answers For Free
Most questions answered within 1 hours.

Ask a Question
ADVERTISEMENT