Question

How is information encoded in DNA used to generate proteins? What is the molecular basis of...

How is information encoded in DNA used to generate proteins? What is the molecular basis of the genetic code?

Homework Answers

Answer #1

Answer- DNA is the genetic material which comprises information in the form of nucleotide base squencing. This information is transferred to mRNA with the help of RNA polymerase. This process is called Transcription. The mRNA then transfers information to tRNA, which helps in the Translation. In this the tRNA binds to ribosome and the polypeptide chain synthesis occurs by coding the amino acid sequences. This helps in generation not the proteins.

The molecular basis for genetic code is DNA. It is composed of a nucleotides sequences:- adenine (A), cytosine (C), guanine (G), and thymine (T). The group of three nucleotides in the sequence is called a codon, that represents either one of the twenty amino acids in a protein ,this is called the genetic code. These sequence of specified amino acids forms a specific protein structure.

Know the answer?
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for?
Ask your own homework help question
Similar Questions
What molecular biology principle is the basis for DNA fingerprinting?
What molecular biology principle is the basis for DNA fingerprinting?
Which of the following represents the correct order in the flow of genetic information? A. DNA-->mRNA-->proteins...
Which of the following represents the correct order in the flow of genetic information? A. DNA-->mRNA-->proteins B. mRNA-->DNA-->proteins C. rRNA-->mRNA-->proteins D. mRNA-->tRNA-->proteins
Explain why DNA is a better material for storing genetic information than proteins.
Explain why DNA is a better material for storing genetic information than proteins.
3. Genetic Information in E. coli DNA The genetic information contained in DNA consists of a...
3. Genetic Information in E. coli DNA The genetic information contained in DNA consists of a linear sequence of coding units, known as codons. Each codon is a specific sequence of three deoxyribonucleotides (three deoxyribonucleotide pairs in double-stranded DNA), and each codon codes for a single amino acid unit in a protein. The molecular weight of an E. coli DNA molecule is about 3.1 3 109 g/mol. The average molecular weight of a nucleotide pair is 660 g/mol, and each...
Mutations can be classi?ed by their effect on the DNA sequence OR the encoded protein. a....
Mutations can be classi?ed by their effect on the DNA sequence OR the encoded protein. a. How do mutations in the DNA alter protein structure? b. How do mutations in proteins alter their function? c. Why are some mutations less deleterious than others?
Several small DNA viruses replicate their DNA in the absense of their own encoded DNA polymerase....
Several small DNA viruses replicate their DNA in the absense of their own encoded DNA polymerase. Explain how this is possible. What virus gene product indirectly faciliates virus DNA synthesis even though it does not function as a polymerase?
What protein product is encoded for by the DNA sequence: (show all work)   TACCTAAAAACTACTACTACTAGTGTGGAGCCACACCCTAGTTGGCCAATCTATCCCAGGAGCAGGGAGGGCAGGAGCCAGGGCTGGGCATAATAC … Please,...
What protein product is encoded for by the DNA sequence: (show all work)   TACCTAAAAACTACTACTACTAGTGTGGAGCCACACCCTAGTTGGCCAATCTATCCCAGGAGCAGGGAGGGCAGGAGCCAGGGCTGGGCATAATAC … Please, show me the steps on how to read sequence.
Ch 16: The Molecular Basis of Inheritance Outline the process of DNA replication in a eukaryotic...
Ch 16: The Molecular Basis of Inheritance Outline the process of DNA replication in a eukaryotic cell in at least 5 steps. Describe enzymes involved for each step and several different chemistry-based explanations for how the steps are performed.
Explain how information in the nervous system is encoded.
Explain how information in the nervous system is encoded.
Question 1 What is the process of separating DNA from the other proteins? What techniques are...
Question 1 What is the process of separating DNA from the other proteins? What techniques are used to accomplish this?    Question 2 How do we isolate the DNA so we have just DNA and can now use other techniques to identify it?