Question

Using this sequence: 5’ AUG GAG AGC CUU GUC CCU 3’ find: a) The translation product,...

Using this sequence: 5’ AUG GAG AGC CUU GUC CCU 3’ find:

a) The translation product, indicating the N terminus and the C terminus, and using the one-letter code for amino acids

b) The complementary non-coding RNA sequence that will serve as a template to the synthesis of other viral genomes, indicating the 5’ and 3’ ends

Homework Answers

Answer #1

The given mRNA sequence: 5’ AUG GAG AGC CUU GUC CCU 3’

a) The translation is a process in which polypeptide is synthesized with mRNA as a template. The set of three bases of the mRNA acts as a codon, each codon codes for an amino acid in the translation process.

So, the amino acid sequence of the polypeptide will be: MET GLU SER LEU VAL PRO

Or in one letter code along with N and C terminus: N - MESLVP - C

b) The complementary non-coding RNA will be complementary to the given RNA sequence. Complementary means that A ic complement to T, G is a complement to C and vice-versa.

So, the complementary RNA will be: 3' UAC CUC UCG GAA CAG GGA 5'

Please hit on the like button if you are satisfied with the answer. Give comments for further clarification/assistance. Thanks! Have a good day.

Know the answer?
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for?
Ask your own homework help question
Similar Questions
(2) Below is the entire transcribed RNA sequence of a prokaryotic gene. 5 GCAUAGCAAAUGAGCAUCAUGUGUCAAUGAGGCGAUG 3 (a)...
(2) Below is the entire transcribed RNA sequence of a prokaryotic gene. 5 GCAUAGCAAAUGAGCAUCAUGUGUCAAUGAGGCGAUG 3 (a) Find the protein-coding sequence and provide the amino acid sequence of the encoded protein (b) Which amino acid is at the C-terminus of this peptide?
A non-template DNA strand has the sequence 5’ -ACGTACAGTCCGT -3’. What is the sequence of ′′the...
A non-template DNA strand has the sequence 5’ -ACGTACAGTCCGT -3’. What is the sequence of ′′the mRNA molecule? The following sequence is located in the middle of an mRNA molecule past the first start codon, so that it is written in the correct reading frame (the first three nucleotides are the first codon, etc.) 5’ – UGC CUG ACA UGC AUC ACG UGG G – 3’. Translate this into a polypeptide (write the amino acid sequence), starting at the beginning...
6. Using a translation table, there is only one possible sequence of nucleotides in the template...
6. Using a translation table, there is only one possible sequence of nucleotides in the template strand of DNA listed below that would code for the polypeptide sequence Phe-Leu-Ile-Val. Identify the correct one and explain for all other choices why they cannot be correct. A) 5' UUG-CUA-CAG-UAG 3'. B) 3' TTT-GTT-TAG-CAG 5'. C) 5' AAG-GAA-TAA-CAA 3'. D) 3' AAA-AAT-ATA-ACA 5'. E) 3' AAA-GAA-TAA-CAA 5'.
QUESTION 25 Using the provided table, what would be the translation of AUG-GCA-CCC-UCA?         MET-ALA-PRO-ISO...
QUESTION 25 Using the provided table, what would be the translation of AUG-GCA-CCC-UCA?         MET-ALA-PRO-ISO         MET-ALA-LEU-SER         MET-THR-PRO-SER         MET-ALA-PRO-SER         MET-ALA-LEU-SER 2.5 points    QUESTION 26 For the RNA code in the question above, what would be the complimentary DNA strand?        TAC-CGT-GGG-AGT        ATG-GCT-GGG-TCA        GAT-TAC-CAG-ATT        UAC-CGU-GGG-AGU        None of the above QUESTION 29 If a proto-oncogene becomes damaged and is no longer able to translate...
II. FILL-IN QUESTIONS 1. The three stages of aerobic respiration are ________________________________,       _____________________________ and _________________________________....
II. FILL-IN QUESTIONS 1. The three stages of aerobic respiration are ________________________________,       _____________________________ and _________________________________. 2.   Microorganisms that are able to respire oxidatively or fermentatively are called     ___________________________________. An example of such an organism is       _________________________________. When they grow aerobically they produce       _____________ ATPs and when they are anaerobic they produce _________ ATPs. 3.   Chemoheterotrophs are able to use _____________________________as a source of       __________________ and carbon, whereas photoautotrophs are able to use            ______________________ as a...
5’…TAC ACC GAT GGA TAA GTC…3’ DNA Coding strand 3’…ATG TGG CTA CCT ATT CAG…5’ DNA...
5’…TAC ACC GAT GGA TAA GTC…3’ DNA Coding strand 3’…ATG TGG CTA CCT ATT CAG…5’ DNA template strand Use the information above to answer the following questions. Write the sequences of the two double-stranded daughter DNAs which will be replicated from the sequence above. Indicate which sequences are directly from the parent. Show accurate direction of each sequence. 0.5 points Write the sequence of the mRNA strand that will be transcribed from the above DNA sequence. Show accurate direction of...
5’…TAC ACC GAT GGA TAA GTC…3’ DNA Coding strand 3’…ATG TGG CTA CCT ATT CAG…5’ DNA...
5’…TAC ACC GAT GGA TAA GTC…3’ DNA Coding strand 3’…ATG TGG CTA CCT ATT CAG…5’ DNA template strand Use the information above to answer the following questions. Write the sequences of the two double-stranded daughter DNAs which will be replicated from the sequence above. Indicate which sequences are directly from the parent. Show accurate direction of each sequence. 0.5 points Write the sequence of the mRNA strand that will be transcribed from the above DNA sequence. Show accurate direction of...
5’…TAC ACC GAT GGA TAA GTC…3’ DNA Coding strand 3’…ATG TGG CTA CCT ATT CAG…5’ DNA...
5’…TAC ACC GAT GGA TAA GTC…3’ DNA Coding strand 3’…ATG TGG CTA CCT ATT CAG…5’ DNA template strand Use the information above to answer the following questions. Write the sequences of the two double-stranded daughter DNAs which will be replicated from the sequence above. Indicate which sequences are directly from the parent. Show accurate direction of each sequence. 0.5 points Write the sequence of the mRNA strand that will be transcribed from the above DNA sequence. Show accurate direction of...
Use the information above to answer the following questions. 5’…TAC ACC GAT GGA TAA GTC…3’ DNA...
Use the information above to answer the following questions. 5’…TAC ACC GAT GGA TAA GTC…3’ DNA Coding strand 3’…ATG TGG CTA CCT ATT CAG…5’ DNA template strand ONLY answer E and F please!! The rest is for reference!! A. Write the sequences of the two double-stranded daughter DNAs which will be replicated from the sequence above. Indicate which sequences are directly from the parent. Show accurate direction of each sequence. 0.5 points B. Write the sequence of the mRNA strand...