Question

How many primers are being used for amplification of a fragment of DNA by PCR:

How many primers are being used for amplification of a fragment of DNA by PCR:

Science   Biology   
0 0
Add a commentTranscribed image text
Next >

Homework Answers

Answer #1

For the amplification of DNA, two primers are always required. One is called the forward primer and the other one is called the reverse primer. Forward Primer binds to the start of template strand (anti-sense strand) while the Reverse primer binds to the end of complementary strand (sense strand). These primers are always complementary to the nucleotide sequences of beginning and terminal sections of DNA to be amplified respectively. The primers always bind to the edges of the sequence to be amplified.

Please do leave a thumbs up and an upvote if this answer really helped you :-)

0 0
Know the answer?
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Log In

Sign Up

Not the answer you're looking for?
Ask your own homework help question
Similar Questions
why does designing exon-spanning primers enables allows for the elimination of genomic DNA amplification during a...
why does designing exon-spanning primers enables allows for the elimination of genomic DNA amplification during a real-time PCR reaction.
The forward and reverse primers for PCR amplification have the following sequences: Forward: 5'-CTATGAGTTACTCACATG-3', Reverse: 5'-...
The forward and reverse primers for PCR amplification have the following sequences: Forward: 5'-CTATGAGTTACTCACATG-3', Reverse: 5'- GAAAGCATCCAGGCCCGG-3'. Based on the manually calculated melting temperatures, would you recommend using these primers together? Why or why not?
Here is the nucleotide sequence of one strand of a fragment of double-stranded DNA, which will...
Here is the nucleotide sequence of one strand of a fragment of double-stranded DNA, which will be amplified by PCR using short primers:      5' TGGCAGTCGATGCTGCTAGCTGGCCTTGAGTCGTGC 3'      Primers that could be used to amplify this entire DNA fragment are: A) 5’ GACTGCCA 3’ & 5’ GCACGACT 3’ B) 5’ GACTGCCA 3’ & 5’ AGTCGTGC 3’ C) 5’ TGGCAGTC 3’ & 5’ GCACGACT 3’ D) 5’ TGGCAGTC 3’ & 5’ AGTCGTGC 3’ E) 5’ TGGCAGTC 3’ & 5’ CGTGCTGA 3’
Which are components of a PCR reaction? Check All That Apply RNA primers Dideoxyribonucleotides DNA ligase...
Which are components of a PCR reaction? Check All That Apply RNA primers Dideoxyribonucleotides DNA ligase Heat–stable DNA polymerase Template DNA Deoxyribonucleotides
After a PCR run using a new set of primers, upon electrophoresis, your gel shows no...
After a PCR run using a new set of primers, upon electrophoresis, your gel shows no amplification bands at all. Suggest three changes to the primers you could make and explain why these changes might lead to a better result.
In reference to PCR, how would you modify regular PCR techniques (used for human DNA) in...
In reference to PCR, how would you modify regular PCR techniques (used for human DNA) in order to identify dinosaur DNA in a fossil?
The difference between PCR and real-time PCR is that real-time PCR: A. can amplify DNA a...
The difference between PCR and real-time PCR is that real-time PCR: A. can amplify DNA a billion-fold within just a few hours, while standard PCR cannot. B. requires primers, while standard PCR does not. C. can determine the DNA sequence, while standard PCR cannot. D. can measure the amount of DNA amplified as the reaction proceeds, while standard PCR cannot. E. uses DNA polymerase, while standard PCR does not.
As a reminder, PCR is the technique used to replicate DNA in the lab. PCR is...
As a reminder, PCR is the technique used to replicate DNA in the lab. PCR is based on the way DNA is replicated in cells. During PCR template DNA plus other ingredients are placed in a test tube and the solution goes through repeated cycles of heating and cooling. You can find more information about PCR here. The 'ingredients' of a basic PCR reaction are: DNA template, primer, nucleotides, DNA polymerase, and any salts required for polymerase function (buffer). No...
What is the average length of oligonucleotide primers used in PCR? a) 6 nucleotides b) 10...
What is the average length of oligonucleotide primers used in PCR? a) 6 nucleotides b) 10 nucleotides c) 20 nucleotides d) 50 nucleotides
How is PCR and DNA fingerprinting used for characterization of bacterial communities in soil, biofilms, or...
How is PCR and DNA fingerprinting used for characterization of bacterial communities in soil, biofilms, or host environments
ADVERTISEMENT
Need Online Homework Help?

Get Answers For Free
Most questions answered within 1 hours.

Ask a Question
ADVERTISEMENT