Question

The DNA sequence of a fragment in the middle of a gene is listed below. Show...

The DNA sequence of a fragment in the middle of a gene is listed below. Show all the possible amino acid sequences that can be coded from this fragment. Hint: Both strands can be used as the template.

5'-ATCGTTCTTAC-3'

3'-TAGCAAGAATG-5'

Please explain.

Science   Biology   
0 0
Add a commentTranscribed image text
Next >

Homework Answers

Answer #1

Answer-

3'-5' DNA sequecne acts as template strand during transcription process. mRNA will form in 5'-3' direction. Polypeptide sequence will contain N- Ile- Val- Leu- Thr- C amino acid residues.

Explanation is provided below:

0 0
Know the answer?
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Log In

Sign Up

Not the answer you're looking for?
Ask your own homework help question
Similar Questions
Previously, we learned about the MC1R gene and its role in hair color. As a natural...
Previously, we learned about the MC1R gene and its role in hair color. As a natural redhead, I was curious about what mutations caused this. I found out that there were several possibilities: the MC1R gene actually has 951 coding nucleotides, so that is a large number of possibilities. TRANSCRIBE and TRANSLATE these two genes and explain what type of mutation this is! Please note, this is only a portion of the gene and does not include a start or...
A non-template DNA strand has the sequence 5’ -ACGTACAGTCCGT -3’. What is the sequence of ′′the...
A non-template DNA strand has the sequence 5’ -ACGTACAGTCCGT -3’. What is the sequence of ′′the mRNA molecule? The following sequence is located in the middle of an mRNA molecule past the first start codon, so that it is written in the correct reading frame (the first three nucleotides are the first codon, etc.) 5’ – UGC CUG ACA UGC AUC ACG UGG G – 3’. Translate this into a polypeptide (write the amino acid sequence), starting at the beginning...
A Scientist has discovered a human gene from cancer cells. The nucleotide sequence of the template...
A Scientist has discovered a human gene from cancer cells. The nucleotide sequence of the template strand of the gene was determined as written below: 3'GACACGTACGAGCCTGGACACCTTAAGAGCGGGCTCGGAACACTGGCCCCGATTGACAC 5' Write down the nucleotide sequence of the DNA fragments produced after EcoRl digestion of this gene. Please explain
The top on is the normal DNA and the corresponding mRNA sequence. The bottom is the...
The top on is the normal DNA and the corresponding mRNA sequence. The bottom is the DNA and mRNA sequence after a mutation. Answer the following questions: NORMAL: Template DNA 5' - CA TAC GTA TTG CAG ATT - 3' mRNA 5' - __________________________________ MUTATED: Template DNA 5' - CA AC GTA ATT GCA GAT T - 3' mRNA 5' - _________________________________ (a) What is the amino acid sequence for the normal protein? (b) What is the amino acid sequence...
Shown below is DNA sequence on the coding strand for a structural gene. 5'-AGGACTAAATGACATGGACACTAACTAGTTGGAAGCTAACCC... -3' How...
Shown below is DNA sequence on the coding strand for a structural gene. 5'-AGGACTAAATGACATGGACACTAACTAGTTGGAAGCTAACCC... -3' How many amino acids does the polypeptide encoded by this sequence contain? A. 7 B. 8 C. 6 D. 12 E. 10
Below is the initial part of the gene sequence for  Glut1 as reported in Flybase. It includes...
Below is the initial part of the gene sequence for  Glut1 as reported in Flybase. It includes the 3' untranslated sequence and the first part of the translated sequence. The promoter for this gene is TATAT. Transcription begins with the third base after the promoter. For each answer portion, in your response, write each one starting on a new line and please write A, B, C, etc. as you go. A)   Transcribe and B). translate this sequence into its final peptide...
A portion of a protein-coding gene is provided for this question. Given the non-template DNA sequence...
A portion of a protein-coding gene is provided for this question. Given the non-template DNA sequence of 5'-TACTATGCTGAGCATTATTGCTAAGTGATGGCTA-3': a. Write the complementary template DNA sequence in a 5' to 3' direction. b. Write the mRNA sequence that would be transcribed from this segment of DNA in a 5' to 3' direction. c. Starting from the first start codon, write the polypeptide sequence that would be translated from the mRNA sequence. d. Define the following terms in your own words: frameshift...
Question 1: Explain what differential gene expression is. Question 2: Examine the following DNA template sequence...
Question 1: Explain what differential gene expression is. Question 2: Examine the following DNA template sequence from a eukaryotic gene, transcription starts with and includes the bold A, the bold sequence (CGTGTCCC) is an intron. 3' CTCCGATATATAAAGGGGTCAGTCTACCGCCTCACGTGTCCCTGCGGGTCACAATT5' Write out the mature mRNA sequence, include an explanation of each modification you made. (hint there are three modifications you have to make).
Find out the nucleotide sequence and fill in the blanks DNA polymerase synthesizes DNA by adding...
Find out the nucleotide sequence and fill in the blanks DNA polymerase synthesizes DNA by adding complementary bases at the end of the primer/growing chain. If the DNA template and the primer sequences are as follows DNA template 5`-ATGCGTGCGTACATACGCAATTCGAACTGCGCTAACGGCCTTGCG-3` Primer 5`-CGAATTGCGTATGT-3` _______ will be the sequence of next 5 bases that will be added to the primer when all reagents needed for DNA synthesis are supplied in the reaction.
A DNA template has the following sequence: 5’-GCTTACTGGCCCGGTTTATTGCCCATCGCC-3’ Infer a transcribed mRNA sequence first, identify the...
A DNA template has the following sequence: 5’-GCTTACTGGCCCGGTTTATTGCCCATCGCC-3’ Infer a transcribed mRNA sequence first, identify the start codon, and determine the complete amino acid sequence that would be translated. Be specific about the amino-terminus and carboxyl-terminus.
ADVERTISEMENT
Need Online Homework Help?

Get Answers For Free
Most questions answered within 1 hours.

Ask a Question
ADVERTISEMENT