Question

Based on the nucleotide sequence below: 1. Write the nucleotide sequence for: a. T7 promoter                           &

Based on the nucleotide sequence below:

1. Write the nucleotide sequence for:

a. T7 promoter                                                                                                                     [2]

b. lac operator                                                                                                                      [2]

c. ribosomal binding site                                                                                                     [2]

d. 6 x His tag                                                                                                                        [2]

e. NcoI restriction enzyme                                                                                                 [2]

f. BamHI restriction enzyme                                                                                          [2]

g. EcoRI restriction enzyme                                                                                              [2]

h. HindIII restriction enzyme                                                                                            [2]

2. Write the amino acid sequence of the translated protein.                                       [7]

3. Calculate the molecular weight of the protein translated.                                       [2]

>RetroMAD

AGATCTCGATCCCGCGAAATTAATACGACTCACTATAGGGGAATTGTGAGCGGATAACAATTCCCCTCTAGAAATAATTTTGTTTAACTTTAAGAAGGAGATATACATATGAAATACCTGCTGCCGACCGCTGCTGCTGGTCTGCTGCTCCTCGCTGCCCAGCCGGCGATGGCCATGGGGCGTATTTGCCGTTGCATTTGCGGCCGTGGCATTTGCCGCTGCATCTGTGGCGTGCCGGGTGTTGGTGTTCCGGGTGTGGGTGGTGCGACCGGATCCGATGTGAACTTTGATCTGAGCACCGCGACCGCGAAAACCTATACCAAATTCATCGAAGATTTTCGTGCGACCCTGCCGTTTAGCCATAAAGTGTATGATATCCCGCTGCTGTATAGCACCATTAGCGATAGCCGTCGTTTTATTCTGCTGGATCTGACCAGCTATGCGTATGAAACCATTAGCGTGGCGATTGATGTGACCAACGTGTATGTGGTGGCGTATCGTACCCGTGATGTGAGCTACTTTTTCAAAGAAAGCCCGCCGGAAGCGTACAACATTCTGTTTAAAGGCACCCGTAAAATTACCCTGCCGTATACCGGCAACTATGAAAACCTGCAGACCGCGGCGCATAAAATTCGTGAAAACATCGATCTGGGCCTGCCGGCCCTGAGCAGCGCGATTACCACCCTGTTTTATTATAACGCGCAGAGCGCGCCGAGCGCGCTGCTGGTGCTGATTCAGACCACCGCGGAAGCGGCGCGTTTTAAATATATTGAACGCCACGTGGCGAAATATGTGGCGACCAACTTTAAACCGAACCTGGCCATTATTAGCCTGGAAAACCAGTGGAGCGCCCTGAGCAAACAAATTTTTCTGGCCCAGAACCAGGGCGGCAAATTTCGTAATCCGGTGGATCTGATTAAACCGACCGGCGAACGTTTTCAGGTGACCAATGTGGATAGCGATGTGGTGAAAGGCAACATTAAACTGCTGCTGAACAGCCGTGCGAGCACCGCGGATGAAAACTTTATTACCACCATGACCCTGCTGGGCGAAAGCGTGGTGGAATTCCCGTGGGCGCTGTGGAAAACCATGCTGAAAGAACTGGGCACGATGGCGCTGCATGCGGGTAAAGCGGCGCTGGGTGCGGCAGCGGATACCATTAGCCAGGGCACCCAGGTTCCGGGCGTGGGCGTTCCGGGCGTTGGTAAGCTTGCGGCCGCACTCGAGCACCACCACCACCACCACTGAGATCCGGCTGCTAACAAAGCCCGAAAGGAAGCTGAGTTGGCTGCTGCCACCGCTGAGCAATAACTAGCATAACCCCTTGGGGCCTCTAAACGGGTCTTGAGGGGTTTTTTG

Science   Biology   
0 0
Add a commentTranscribed image text
Next >

Homework Answers

Answer #1

Question 1

a) T7 Promoter- 5' – TAATACGACTCACTATAG – 3'

b) lac operator-5′--T G G A A T T G T G A G C G G A T A A C A A T T -3′

c)ribosomal binding site- 5'- AAAGANNNGANNN -3'

d)6 x His tag- 5-'GTAGTAGTAGTAGTAGTA- 3'

e)NcoI Restriction enzyme - 5'-CCATGG- 3'

f)BamHI Restriction enzyme- 5'-GGATCC- 3'

g)EcoRI restriction enzyme - 5'-GAATTC- 3'

h)Hind III Restriction enzyme- 5'- AAGCTT- 3'

Question 2

  • Transcribe the DNA to RNa
  • Translate the resulting RNA sequence into the amino acid sequence

DNA : TAC AAA GCT TCA GGC CCT GAT ATC

mRNA : AUG UUU CGA AGU CCG GGA CUA UAG

Amino

acids : Met Phe Arg   Ser Pro Gly Lue Stop

0 0
Know the answer?
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Log In

Sign Up

Not the answer you're looking for?
Ask your own homework help question
Similar Questions
1. Use the numbers in the choices below to indicate where in the schematic diagram of...
1. Use the numbers in the choices below to indicate where in the schematic diagram of a eukaryotic cell those processes take place. Write each number 1-5 next to “nucleus,” “ribosomes,” or “endoplasmic reticulum.” transcription translation RNA splicing polyadenylation RNA capping 2. (True / False) A linear chromosome can have multiple origins of replication. 3. Part of the RNA sequence below encodes the N-terminal region of a protein, but not all of the nucleotides shown are translated into protein. Given...
1.When a protein binds to DNA at a site defined by a particular nucleotide sequence, with...
1.When a protein binds to DNA at a site defined by a particular nucleotide sequence, with which parts of the DNA does the protein primarily interact? A. the phosphate and deoxyribose groups in the DNA backbone B. the phosphate and deoxyribose groups in the DNA backbone, and hydrophobic interactions with the nucleotide bases C. nucleotide bases within the major grooves of the DNA D. nucleotide bases within the major and minor grooves of the DNA E. none of the above...
12. If the DNA repair mechanisms fail to correct a defect in nucleotide sequencing, a permanent...
12. If the DNA repair mechanisms fail to correct a defect in nucleotide sequencing, a permanent change known as a __________________ may result. 13. As the enzyme helicase opens and “unzips” the two strands of DNA by breaking the hydrogen bonds, a Y-shaped ________________________ forms. a. Lagging strand b. Leading strand c. Okazaki fragment d. Replication fork 14. One large difference between transcription and translation between prokaryotes and eukaryotes is that, in prokaryotes: a. Translation occurs simultaneously with transcription b....
Bioinformatics #3 1. According to the PDB page for 1GBT and the PubChem database, the substrate...
Bioinformatics #3 1. According to the PDB page for 1GBT and the PubChem database, the substrate used in this study to yield the acyl–enzyme intermediate was ___________, which has a monoisotopic molecular weight of ________. 4-nitrophenyl-4-guanidinobenzoate; 300.26948 g/mole 1-nitrophenyl-1-guanidinobenzoate; 300.26948 g/mole 4-nitrophenyl-4-guanidinobenzoate; 300.085855 g/mole 1-nitrophenyl-1-guanidinobenzoate; 300.085855 g/mole 2. As observed in Protein Workshop, the guanidinobenzoyl group of the substrate is bound to the domain of the protein that ___________ contain the L1 and L2 regions. does not does 3. Which...
1. As the RNA polymerase is synthesizing new RNA, it uses one strand of the DNA...
1. As the RNA polymerase is synthesizing new RNA, it uses one strand of the DNA as a template and it adds a new nucleotide to which end of the growing RNA strand? As it moves along the DNA template, which direction is the polymerase moving? 2. In eukaryotes, the genomic DNA is packaged with proteins called histones. What is the term for the combination of DNA + histones? 3. In eukaryotes, when the initial RNA is transcribed, is it...
7.)In G proteins, which form of the guanyl nucleotide is bound in the unactivated state? a.)...
7.)In G proteins, which form of the guanyl nucleotide is bound in the unactivated state? a.) GTP b.) GDP c.) GMP d.) dGTP e.) None of above 8.)which of the following amino acids can be phophorylated? a.) tyrosine, serine, theronine b.) tyrosine, serine, tryptophan c.) serine, threonine, asparagine d.) histidine, serine, phenylalanine e.) tyrosine, methionine, typrtophan 9.) most signal molecules: a.)easily diffuse through the membrane and bind to a receptor in the cytoplasm b.) bind to membrane receptors and transmit...
1) E. coli cells are growing in medium containing lactose but no glucose. Briefly describe the...
1) E. coli cells are growing in medium containing lactose but no glucose. Briefly describe the consequence of the following changes (one to two sentences for each condition): a. Addition of high concentration of glucose. b. A mutation that inactivates galactoside permease. c. A mutation that inactivates beta-galactosidase. d. A mutation that affects binding of CAP to c-AMP e. A mutation that affects binding of inducer to LacI f. A lac operator mutation that deletes all of the O1 2)...
1.A technique used to identify RNA after gel electrophoresis and which employs ssDNA in the detection...
1.A technique used to identify RNA after gel electrophoresis and which employs ssDNA in the detection process is the _____ blot. Select one: a. Northern b. Western c. Northeastern d. Southern e. Southwestern 2. DNA sequencing by controlled termination of replication is called the _____ method. Select one: a. Sanger b. E. coli c. Restriction enzymes d. DNA Microarray e. Ligase f. Polymerase Chain Reaction g. Footprint h. Reverse Trancriptase i. Vector j. Expression k. Fluorescent l. cDNA 3. How...
Read each question carefully. Write your response in the space provided for each part of each...
Read each question carefully. Write your response in the space provided for each part of each question. Answers must be written out in paragraph form. Outlines, bulleted lists, or diagrams alone are not acceptable and will not be scored. Atherosclerosis is a disease that results when certain cells and proteins of an individual’s body adhere to and damage blood vessels, especially those around the heart. Researchers continue to look for improved ways to treat individuals with the disease. Data obtained...
When is a hypothesis considered scientific? a. when it is based on something other than observation...
When is a hypothesis considered scientific? a. when it is based on something other than observation b. when it can be tested and is refutable c. when it relies on anecdotal evidence d. when it relies on mystical explanations e. All hypotheses are considered scientific until experiments determine otherwise. 3. Of the following, which is the earliest step in the scientific process? a. generating a hypothesis b. analyzing data c. conducting an experiment d. drawing a conclusion e. developing a...
ADVERTISEMENT
Need Online Homework Help?

Get Answers For Free
Most questions answered within 1 hours.

Ask a Question
ADVERTISEMENT