Question

Which among the following is NOT important for PCR primer designing? A. Whole genome sequence B....

  1. Which among the following is NOT important for PCR primer designing?

A.

Whole genome sequence

B.

Protein

C.

mRNA

D.

Primer 3
Science   Biology   
0 0
Add a commentTranscribed image text
Next >

Homework Answers

Answer #1

(C) mRNA is not required for primer designing.

PCR primers are short single-stranded DNA sequences which help in the amplification of DNA during Polymerase Chain Reaction. It provides a starting point for DNA synthesis.

The key to the PCR lies in the design of two oligonucleotide primers.

  • For this information has to be sequenced using large strech of DNA stored in computer base.(hence (a) whole genome sequence is required for genome sequencing held in gene databases)
  • A number of software developments have allowed the process of primer design to be straight forward. Example (d)Primer3
  • For primers synthesis, Primase enzyme is required which is a heterodimeric protein structure. Hence (B) protein is required.
0 0
Know the answer?
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Log In

Sign Up

Not the answer you're looking for?
Ask your own homework help question
Similar Questions
A) Complete the following diagram by giving the template sequence, the mRNA sequence and peptide sequence.(The...
A) Complete the following diagram by giving the template sequence, the mRNA sequence and peptide sequence.(The genetic code is provided below)Complete the following diagram by giving the template sequence, the mRNA sequence and peptide sequence.(The genetic code is provided below) Coding:            5’ GCT GAT CAG CTG ACC GAA GAA CAG ATT 3’ Template:     3’ ___ ___ ___   ___ ___ ___ ___   ___ ___ 5’ mRNA:            5’ ___ ___ ___ ___ ___ ___ ___   ___ ___ 3’ Protein:                  N   ...
RNA polymerase requires which of the following for initiation? A. DNA primer B. RNA primer C....
RNA polymerase requires which of the following for initiation? A. DNA primer B. RNA primer C. Supercoiled DNA D. Nicked DNA E. None of the above
Which purified genome is infectious upon transfection into cells? A. (-)ssRNA genome since it can serve...
Which purified genome is infectious upon transfection into cells? A. (-)ssRNA genome since it can serve as mRNA. B. (+)ssRNA genome and (-)ssRNA genome. (-)ssRNA genome can be infectious upon transfection since it serves as mRNA and can be readily translated. C. (+)ssRNA genome, but (-)ssRNA genome can also be infectious upon transfection. D. (+)ssRNA genome since it can serve as mRNA. (-)ssRNA genome can not be infectious upon transfection and it needs (+)strand synthesis and replication. E. (+)ssRNA genome,...
which 10-bp primer can be used to amplify the following DNA sequence? 5'-GTCATTGCCTAGCCTAAGCTAAAGCTA-3' which of the...
which 10-bp primer can be used to amplify the following DNA sequence? 5'-GTCATTGCCTAGCCTAAGCTAAAGCTA-3' which of the following amino acids yield TCA cycle intermediates when deaminated? Aspartate and Alanine Glutamate and Asparate Alanine and Glutamate Arginine and Aspartate Glutamate and Arginine
Fragment of double-stranded DNA: 5' TGGCAGTCGATGCTGCTAGCTGGCCTTGAGTCGTGC 3' Which primer could amplify the whole fragment of the...
Fragment of double-stranded DNA: 5' TGGCAGTCGATGCTGCTAGCTGGCCTTGAGTCGTGC 3' Which primer could amplify the whole fragment of the following? a) 5’ GACTGCCA 3’ & 5’ GCACGACT 3’ b) 5’ GACTGCCA 3’ & 5’ AGTCGTGC 3’ c) 5’ TGGCAGTC 3’ & 5’ GCACGACT 3’ d) 5’ TGGCAGTC 3’ & 5’ AGTCGTGC 3’ e) 5’ TGGCAGTC 3’ & 5’ CGTGCTGA 3’
PLEASE ANSWER THESE QUESTIONS 1.The annotated sequence of the HIV genome allows biologists to identify drugs...
PLEASE ANSWER THESE QUESTIONS 1.The annotated sequence of the HIV genome allows biologists to identify drugs that can interfere with the HIV cycle and prevent infection.  The annotated genome of HIV containing the open reading frame BLANK , which is a gene that encodes protein components of the capsid,BLANK , which encodes proteins needed for reverse transcription and incorporation into the host DNA, and BLANK, which encodes proteins that are embedded in the lipid envelope. 2.In bacteria, the supercoils of DNA...
1.When a protein binds to DNA at a site defined by a particular nucleotide sequence, with...
1.When a protein binds to DNA at a site defined by a particular nucleotide sequence, with which parts of the DNA does the protein primarily interact? A. the phosphate and deoxyribose groups in the DNA backbone B. the phosphate and deoxyribose groups in the DNA backbone, and hydrophobic interactions with the nucleotide bases C. nucleotide bases within the major grooves of the DNA D. nucleotide bases within the major and minor grooves of the DNA E. none of the above...
The top on is the normal DNA and the corresponding mRNA sequence. The bottom is the...
The top on is the normal DNA and the corresponding mRNA sequence. The bottom is the DNA and mRNA sequence after a mutation. Answer the following questions: NORMAL: Template DNA 5' - CA TAC GTA TTG CAG ATT - 3' mRNA 5' - __________________________________ MUTATED: Template DNA 5' - CA AC GTA ATT GCA GAT T - 3' mRNA 5' - _________________________________ (a) What is the amino acid sequence for the normal protein? (b) What is the amino acid sequence...
PCR Questions What gives DNA strands its polarity? To answer, tell me what the “ 5’...
PCR Questions What gives DNA strands its polarity? To answer, tell me what the “ 5’ ” and “ 3’ ” ends are referring to in chemical terms.   Diagram a “template” and the primers for a PCR reaction, including the 5’ and 3’ notations as appropriate. Will the “forward” primer have the same sequence as the coding strand or complement strand? Will the “reverse” primer have the same sequence as the coding strand or complement strand? After running PCR, a...
Consider the following scenarios and select which DNA technology is the best to use, options listed...
Consider the following scenarios and select which DNA technology is the best to use, options listed after scenarios. A. You want to sequence several DNA fragments within a rare bird species' genome, but you don't know anything about the species' genome. Select one: Illumina sequencing, Sanger sequencing, Gene cloning OR PCR B. You want to make copies of an STR locus in order to determine the genotype of a patient. Because this is a human STR, the sequence near the...
ADVERTISEMENT
Need Online Homework Help?

Get Answers For Free
Most questions answered within 1 hours.

Ask a Question
ADVERTISEMENT