Question

Given the following prokaryote sequence of DNA: Identify if any promoter sequences are present in DNA...

Given the following prokaryote sequence of DNA: Identify if any promoter sequences are present in DNA SEQ1 (Highlight/Underline these in the sequence) Predict the mRNA sequence that would arise from this DNA sequence. Identify the ribosome binding site, start and stop codons (if present). (Highlight/Underline these in the sequence). Predict the sequence of the peptide that would arise from the predicted mRNA sequence using the genetic code table (see Codon usage table). Based on your knowledge of the properties of amino acids speculate on the properties of the predicted peptide (e.g. charge, hydrophobicity, aromaticity) 5’TAAAATCACCTTTCATTGACACCACAATCACATCTCTACGTATAATGAATTTAAAGCGGAGGCAAATTTGCCCCCCAATGCTTTTTGTCGACTTCGACTTTAAATGCTCAAAAGGAGGCAAATGAAAACTT 3’

Science   Biology   
0 0
Add a commentTranscribed image text
Next >

Homework Answers

Answer #1

Answer is attached by mentioning step wise page number

0 0
Know the answer?
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Log In

Sign Up

Not the answer you're looking for?
Ask your own homework help question
Similar Questions
The following template sequence of DNA was isolated from a bacterial cell. Identify the promoter region...
The following template sequence of DNA was isolated from a bacterial cell. Identify the promoter region (assume there is no operator) and transcribe the DNA to the right of the promoter. Once you’ve transcribed the DNA into mRNA, find the start codon and translate the sequence into the correct amino acids to create a polypeptide. 3’-AATATTTATTATATAACCCGGCATACGTTCGGACGTCCCATATAGACTCCATTCGACTT-5’
10. Given the following DNA sequence as the template strand: TTACGATGCCCA Finish the complementary DNA strand....
10. Given the following DNA sequence as the template strand: TTACGATGCCCA Finish the complementary DNA strand. AAT _ _ _ _ _ _ _ _ _ Finish the corresponding mRNA (use template strand) AAU _ _ _ _ _ _ _ _ _ Finish the corresponding protein sequence from the mRNA. (Use the table on mRNA codons to identify the protein sequence. For example, the mRNA codon AAU codes for the amino acid, asparagine, Asn. Asn-____-____-____ What would be the...
A. Using the genetic code table, answer the following questions: Determine the sequence of amino acids...
A. Using the genetic code table, answer the following questions: Determine the sequence of amino acids from an mRNA sequence CCGUGU Determine the sequence of amino acids from a DNA template strand AATGTT List the start codon List the stop codons
A DNA template has the following sequence: 5’-GCTTACTGGCCCGGTTTATTGCCCATCGCC-3’ Infer a transcribed mRNA sequence first, identify the...
A DNA template has the following sequence: 5’-GCTTACTGGCCCGGTTTATTGCCCATCGCC-3’ Infer a transcribed mRNA sequence first, identify the start codon, and determine the complete amino acid sequence that would be translated. Be specific about the amino-terminus and carboxyl-terminus.
5’…TAC ACC GAT GGA TAA GTC…3’ DNA Coding strand 3’…ATG TGG CTA CCT ATT CAG…5’ DNA...
5’…TAC ACC GAT GGA TAA GTC…3’ DNA Coding strand 3’…ATG TGG CTA CCT ATT CAG…5’ DNA template strand Use the information above to answer the following questions. Write the sequences of the two double-stranded daughter DNAs which will be replicated from the sequence above. Indicate which sequences are directly from the parent. Show accurate direction of each sequence. 0.5 points Write the sequence of the mRNA strand that will be transcribed from the above DNA sequence. Show accurate direction of...
5’…TAC ACC GAT GGA TAA GTC…3’ DNA Coding strand 3’…ATG TGG CTA CCT ATT CAG…5’ DNA...
5’…TAC ACC GAT GGA TAA GTC…3’ DNA Coding strand 3’…ATG TGG CTA CCT ATT CAG…5’ DNA template strand Use the information above to answer the following questions. Write the sequences of the two double-stranded daughter DNAs which will be replicated from the sequence above. Indicate which sequences are directly from the parent. Show accurate direction of each sequence. 0.5 points Write the sequence of the mRNA strand that will be transcribed from the above DNA sequence. Show accurate direction of...
5’…TAC ACC GAT GGA TAA GTC…3’ DNA Coding strand 3’…ATG TGG CTA CCT ATT CAG…5’ DNA...
5’…TAC ACC GAT GGA TAA GTC…3’ DNA Coding strand 3’…ATG TGG CTA CCT ATT CAG…5’ DNA template strand Use the information above to answer the following questions. Write the sequences of the two double-stranded daughter DNAs which will be replicated from the sequence above. Indicate which sequences are directly from the parent. Show accurate direction of each sequence. 0.5 points Write the sequence of the mRNA strand that will be transcribed from the above DNA sequence. Show accurate direction of...
Use the information above to answer the following questions. 5’…TAC ACC GAT GGA TAA GTC…3’ DNA...
Use the information above to answer the following questions. 5’…TAC ACC GAT GGA TAA GTC…3’ DNA Coding strand 3’…ATG TGG CTA CCT ATT CAG…5’ DNA template strand ONLY answer E and F please!! The rest is for reference!! A. Write the sequences of the two double-stranded daughter DNAs which will be replicated from the sequence above. Indicate which sequences are directly from the parent. Show accurate direction of each sequence. 0.5 points B. Write the sequence of the mRNA strand...
Below is the initial part of the gene sequence for  Glut1 as reported in Flybase. It includes...
Below is the initial part of the gene sequence for  Glut1 as reported in Flybase. It includes the 3' untranslated sequence and the first part of the translated sequence. The promoter for this gene is TATAT. Transcription begins with the third base after the promoter. For each answer portion, in your response, write each one starting on a new line and please write A, B, C, etc. as you go. A)   Transcribe and B). translate this sequence into its final peptide...
12. If the DNA repair mechanisms fail to correct a defect in nucleotide sequencing, a permanent...
12. If the DNA repair mechanisms fail to correct a defect in nucleotide sequencing, a permanent change known as a __________________ may result. 13. As the enzyme helicase opens and “unzips” the two strands of DNA by breaking the hydrogen bonds, a Y-shaped ________________________ forms. a. Lagging strand b. Leading strand c. Okazaki fragment d. Replication fork 14. One large difference between transcription and translation between prokaryotes and eukaryotes is that, in prokaryotes: a. Translation occurs simultaneously with transcription b....
ADVERTISEMENT
Need Online Homework Help?

Get Answers For Free
Most questions answered within 1 hours.

Ask a Question
ADVERTISEMENT