Question

What kind of mutation is p.R347H? What kind of mutation is 0.D979A? What kind of mutation...

What kind of mutation is p.R347H?
What kind of mutation is 0.D979A?
What kind of mutation it delta F508?
Answer key:
Transverse
nonsense
aneuploidy
inversion
missense
polyploidy
transition
translocation
deletion
insertion
frameshift

Homework Answers

Answer #1

Answers:-

1) p.R347H is a missense mutation.

It occurs in cystic fibrosis where a single nucleotide is changed, thus results in products of different codon.

2)0.D979A is a deletion mutation.

This type of mutation occurs in cystic fibrosis,in which there is deletion of three DNA bases that results in different protein formation.

3)delta F508 is a deletion mutation.

Mutation in DeltaF508 results from deletion of three nucleotides bases which results in a loss of phenylalanine at the 508th position on the protein. This results in abnormal folding of the protein and gets degraded sooner.

Know the answer?
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for?
Ask your own homework help question
Similar Questions
Transcribe and translate the normal sequence and the mutated sequence. Identify what type of DNA mutation...
Transcribe and translate the normal sequence and the mutated sequence. Identify what type of DNA mutation occurred. (insertion, deletion, or substitution) Identify what type of protein change resulted. (frameshift, missense, nonsense, or silent) Normal Sequence 3’ TACCTTCACCGCAGGGTAGCTTTTATTTAA 5’ Mutated sequence 3’ TACCTTCACCGCAGGTAGCTTTTATTTAA 5’
Transcribe and translate the normal sequence and the mutated sequence. Identify what type of DNA mutation...
Transcribe and translate the normal sequence and the mutated sequence. Identify what type of DNA mutation occurred. (insertion, deletion, or substitution) Identify what type of protein change resulted. (frameshift, missense, nonsense, or silent) normal sequence- 3' TAC GGA GCA GGG CCA AAA AAC TGT TTT ACT 5´ mutated sequence- 3´ TAC GGA GCA GGG CCA CCA AAC TGT TTT ACT 5´
Q 16, Here is the coding region for two strains of the same bacterial species: Strain...
Q 16, Here is the coding region for two strains of the same bacterial species: Strain 1: 5' - GTACTAACCATATTCACC - 3' Strain 2: 5' - GCTACTAACCATATTCACC - 3' There should only be one correct answer. Thank you! Assume this region is translated. Select the true statement: 1. This is a deletion mutation that results in frameshift. 2. This is a substitution mutation resulting in missense. 3. This is an insertion mutation that is silent. 4. This is an insertion...
During cell division, DNA undergoes replication. DNA is transcribed into mRNA and the genetic code is...
During cell division, DNA undergoes replication. DNA is transcribed into mRNA and the genetic code is translated into a polypeptide sequence. Out of these three processes, which is most likely to be the site a deletion, frameshift, insertion missense, nonsense, point and silent mutation or alteration occurred? Explain why you have chosen this process.
Pick a mutation that is caused by either DNA substitution, Insertion or Deletion. (1) What is...
Pick a mutation that is caused by either DNA substitution, Insertion or Deletion. (1) What is the error (list the letters) in the DNA?   (2) Did it cause Missense Substitution, Nonsense Substitution or Frame shifting (3) Which Amino Acid or Protein does it create and which amino acid or protein does it normally create (without the mutation)? (3) What effects does it have on the body? (4) List website/references where you retrieved your material.
Insertion/deletion (indel) mutations typically cause frameshift mutations. a. What is meant by a frameshift mutation? b....
Insertion/deletion (indel) mutations typically cause frameshift mutations. a. What is meant by a frameshift mutation? b. Describe two situations in which an indel mutation would not be expected to cause a frameshift. c. How could an indel mutation arise spontaneously? d. Name a disease resulting from insertions (hint: think about diseases that result form the process you identified in part c.
Flag this Question Question 491 pts A neutral missense mutation is a mutation that Group of...
Flag this Question Question 491 pts A neutral missense mutation is a mutation that Group of answer choices Gives rise to another codon, which nonetheless specifies the same amino acid Gives rise to another codon, which specifies a chemically similar amino acid (so that protein function remains unaffected) Gives rise to another codon, which is not translated Flag this Question Question 501 pts Consider the following codon for lysine: 5’-AAA-3’. The DNA is mutated in such a way that this...
What type of mutation is shown? :Wildtype sequence template DNA strand 3’ TACAGTGGGTTC 5’    coding...
What type of mutation is shown? :Wildtype sequence template DNA strand 3’ TACAGTGGGTTC 5’    coding DNA strand 5’ ATGTCACCCAAG 3’    Mutant Sequence: template DNA strand 3’ TACAATGGGTTC 5’ coding DNA strand 5’ ATGTTACCCAAG 3’ a.) a missense mutation b.) a frameshift mutation c.) an exonic mutation d.) a silent mutation e.) a nonsense mutation
If the guanine (G) in the DNA sequence 3’ TTACGTTTC is deleted, what are the first...
If the guanine (G) in the DNA sequence 3’ TTACGTTTC is deleted, what are the first 2 amino acids that will be joined at the ribosome? Remember there is a START codon. Use the information on this chart to answer the question. asparagine, alanine methionine, glutamine leucine, glycine leucine, phenylalanine methionine, lysine The mutation in the above question is an example of a ________________ mutation. Group of answer choices frameshift nonsense missense silent
Exposure to a mutagen caused the following DNA change within exon #1 of a gene. What...
Exposure to a mutagen caused the following DNA change within exon #1 of a gene. What type of mutation is this? Wildtype sequence template DNA strand 3’ TACAGTGGGTTC 5’    coding DNA strand 5’ ATGTCACCCAAG 3’    Mutant Sequence template DNA strand 3’ TACAATGGGTTC 5’ coding DNA strand 5’ ATGTTACCCAAG 3 a missense mutation a silent mutation an exonic mutation a frameshift mutation a nonsense mutation
ADVERTISEMENT
Need Online Homework Help?

Get Answers For Free
Most questions answered within 1 hours.

Ask a Question
ADVERTISEMENT