Question

if there is a mutation that occurs on the seventh DNA codon on the template strand...that...

if there is a mutation that occurs on the seventh DNA codon on the template strand...that transforms a Guanine to an Adenine in the sequence. What would be the overall effect on the synthesis of the protein and why?

Homework Answers

Answer #1

If there is a mutation that ocurs on the seventh DNA codon on the template strand ... that transforms a Guanine to an Adenine in the sequence.

Here one base is changed , guanine is changed to adenine in the template strand. The mRNA is coded by template strand. If one base is changed in the template strand , it affects the corresponding base in the mRNA. When Guanine is present on the template strand , the seventh codon on mRNA was cytosine. Now guanine is changed to adenine. So seventh codon in the mRNA changes to Uracil. This affects the one  aminoacid coded by mRNA. There is a change polypeptide produced. It affects protein synthesis. There is a change in one aminoacid when compared to the sequence prior to mutation.

This mutation on template strand affects the synthesis of protein.

Know the answer?
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for?
Ask your own homework help question
Similar Questions
10. Given the following DNA sequence as the template strand: TTACGATGCCCA Finish the complementary DNA strand....
10. Given the following DNA sequence as the template strand: TTACGATGCCCA Finish the complementary DNA strand. AAT _ _ _ _ _ _ _ _ _ Finish the corresponding mRNA (use template strand) AAU _ _ _ _ _ _ _ _ _ Finish the corresponding protein sequence from the mRNA. (Use the table on mRNA codons to identify the protein sequence. For example, the mRNA codon AAU codes for the amino acid, asparagine, Asn. Asn-____-____-____ What would be the...
What type of mutation is shown? :Wildtype sequence template DNA strand 3’ TACAGTGGGTTC 5’    coding...
What type of mutation is shown? :Wildtype sequence template DNA strand 3’ TACAGTGGGTTC 5’    coding DNA strand 5’ ATGTCACCCAAG 3’    Mutant Sequence: template DNA strand 3’ TACAATGGGTTC 5’ coding DNA strand 5’ ATGTTACCCAAG 3’ a.) a missense mutation b.) a frameshift mutation c.) an exonic mutation d.) a silent mutation e.) a nonsense mutation
A non-template DNA strand has the sequence 5’ -ACGTACAGTCCGT -3’. What is the sequence of ′′the...
A non-template DNA strand has the sequence 5’ -ACGTACAGTCCGT -3’. What is the sequence of ′′the mRNA molecule? The following sequence is located in the middle of an mRNA molecule past the first start codon, so that it is written in the correct reading frame (the first three nucleotides are the first codon, etc.) 5’ – UGC CUG ACA UGC AUC ACG UGG G – 3’. Translate this into a polypeptide (write the amino acid sequence), starting at the beginning...
ANSWER KEY Recombinant DNA Anticodon Mutation Uracil Codon Replication tRNA Thymine Antiparallel Translation Transcription Polymerase Chain...
ANSWER KEY Recombinant DNA Anticodon Mutation Uracil Codon Replication tRNA Thymine Antiparallel Translation Transcription Polymerase Chain Reaction Match the correct answer with the corresponding statement. A base found in RNA but not DNA A base found in DNA but not RNA The opposite directions run by two strands of DNA double helix Protein synthesis When mRNA is synthesized from DNA When a strand of DNA makes a new copy prior to cell division The RNA that carries amino acids to...
A portion of a protein-coding gene is provided for this question. Given the non-template DNA sequence...
A portion of a protein-coding gene is provided for this question. Given the non-template DNA sequence of 5'-TACTATGCTGAGCATTATTGCTAAGTGATGGCTA-3': a. Write the complementary template DNA sequence in a 5' to 3' direction. b. Write the mRNA sequence that would be transcribed from this segment of DNA in a 5' to 3' direction. c. Starting from the first start codon, write the polypeptide sequence that would be translated from the mRNA sequence. d. Define the following terms in your own words: frameshift...
Transcribe and translate the following bacterial template DNA strand TACCCCAACTACCATATACTTCAAGAAATC mRNA Sequence: Protein Primary structure:
Transcribe and translate the following bacterial template DNA strand TACCCCAACTACCATATACTTCAAGAAATC mRNA Sequence: Protein Primary structure:
A DNA template strand has the following base sequence: 5' TTACACGTGGACTGAGGACCTCTCCAT 3' 1.) What is sequence...
A DNA template strand has the following base sequence: 5' TTACACGTGGACTGAGGACCTCTCCAT 3' 1.) What is sequence of bases that in the complimentary strand of DNA? 2.) What is the mRNA that would be transcribed from this DNA?
What must be added to the template strand before DNA polymerase can begin synthesis of a...
What must be added to the template strand before DNA polymerase can begin synthesis of a new DNA strand?
1.a) In the genetic code, the codon GAU encodes _________. Select one: a. Aspartic acid. b....
1.a) In the genetic code, the codon GAU encodes _________. Select one: a. Aspartic acid. b. Asparagine. c. Terminator (stop codon). d. Serine. e. Methionine (initiator codon). b) An individual with the genetic condition cystic fibrosis has a CFTR protein with the amino acid histidine at position 482. The normal CFTR protein has arginine. at position 482. No other changes are observed in the protein. This is change is likely the result of a _________ mutation. Select one: a. Frameshift....
Molecular Biology and Biochemistry A DNA strand which is used as the template for transcription is...
Molecular Biology and Biochemistry A DNA strand which is used as the template for transcription is known as the ________. leading strand sense strand antisense strand lagging strand coding strand Sickle cell disease results from a point mutation of the __________. α-globin of hydrophilic amino acid for a hydrophobic amino acid β-globin of histidine for glycine β-globin of valine for glutamate γ-globin of proline for tyrosine γ-globin of glutamate for guanine Which of the following molecules has RNA-dependent DNA polymerase...
ADVERTISEMENT
Need Online Homework Help?

Get Answers For Free
Most questions answered within 1 hours.

Ask a Question
ADVERTISEMENT