Question

What protein product is encoded for by the DNA sequence: (show all work)   TACCTAAAAACTACTACTACTAGTGTGGAGCCACACCCTAGTTGGCCAATCTATCCCAGGAGCAGGGAGGGCAGGAGCCAGGGCTGGGCATAATAC … Please,...

What protein product is encoded for by the DNA sequence: (show all work)   TACCTAAAAACTACTACTACTAGTGTGGAGCCACACCCTAGTTGGCCAATCTATCCCAGGAGCAGGGAGGGCAGGAGCCAGGGCTGGGCATAATAC …

Please, show me the steps on how to read sequence.

Science   Anatomy-And-Physiology   
0 0
Add a commentTranscribed image text
Next >

Homework Answers

Answer #1

DNA sequence is

TACCTAAAAACTACTACTACTAGTGTGGAGCCACACCCTAGTTGGCCAATCTATCCCAGGAGCAGGGAGGGCAGGAGCCAGGGCTGGGCATAATAC

Step 1: form mRNA from the DNA given above

AUCCAUUUUUGAUGAUGAUGAUCACACCUCGGUGUGGGUCAA

CCGGUUAGAUAGGGUCCUCGUCCCUCCCGUCCUCGGUCCCGACCCGUAUUAUG

Step 2 : find STRT CODON AUG and the from that find stop codon by considering triplet pairs. (UAG) ​​​​​​

Step 3 : decode the MRNA from AUG to UAG.

AUG= Methionine

AUC= isoleucine

ACA= threonine

CCU= proline

CGG=arginine

UGU= cysteine

GGG= glycine

UCA= serine

ACC = threonine

GGU=glycine

UAG = stop codon

So protein will have

Methionine - Methionine - methionine - isoleucine-threonine - proline - arginine - cysteine - glycine - serine - threonine - glycine

0 0
Know the answer?
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Log In

Sign Up

Not the answer you're looking for?
Ask your own homework help question
Similar Questions
Mutations can be classi?ed by their effect on the DNA sequence OR the encoded protein. a....
Mutations can be classi?ed by their effect on the DNA sequence OR the encoded protein. a. How do mutations in the DNA alter protein structure? b. How do mutations in proteins alter their function? c. Why are some mutations less deleterious than others?
How to co-relate DNA sequence to protein sequence? How to co-relate DNA sequence to protein sequence...
How to co-relate DNA sequence to protein sequence? How to co-relate DNA sequence to protein sequence of PTC receptor (or TAS2R38 gene)?
Several small DNA viruses replicate their DNA in the absense of their own encoded DNA polymerase....
Several small DNA viruses replicate their DNA in the absense of their own encoded DNA polymerase. Explain how this is possible. What virus gene product indirectly faciliates virus DNA synthesis even though it does not function as a polymerase?
Given the following DNA sequence, what is the mRNA sequence? How many amino acids would be...
Given the following DNA sequence, what is the mRNA sequence? How many amino acids would be created from this strand of DNA? TAC GGC CTA TAC GTA Please explain this process, don't just write the answer. I think it will be ARG CCG GAT ATG CAT, but I'm not sure. How would I know how many amino acids would be created? My teacher didn't really explain that part to me.
You want to confirm the interaction of a particular protein with a specific sequence of DNA...
You want to confirm the interaction of a particular protein with a specific sequence of DNA within the context of a living cell. What technique would you use and why?
What is protein synthesis? A) Protein synthesis is the process through which cells capture DNA and...
What is protein synthesis? A) Protein synthesis is the process through which cells capture DNA and chemically "force" it to do their "bidding." B) Protein synthesis is the process through which cells decay, also known as necrosis. C) Protein synthesis is the process through which cells read DNA and build the molecular components of new cells. D) Protein synthesis is the process through which cells read DNA, and then edit it in order to produce a genome that is more...
How is information encoded in DNA used to generate proteins? What is the molecular basis of...
How is information encoded in DNA used to generate proteins? What is the molecular basis of the genetic code?
Transcribe and translate the normal sequence and the mutated sequence. Identify what type of DNA mutation...
Transcribe and translate the normal sequence and the mutated sequence. Identify what type of DNA mutation occurred. (insertion, deletion, or substitution) Identify what type of protein change resulted. (frameshift, missense, nonsense, or silent) Normal Sequence 3’ TACCTTCACCGCAGGGTAGCTTTTATTTAA 5’ Mutated sequence 3’ TACCTTCACCGCAGGTAGCTTTTATTTAA 5’
Please explain and show all work on how to solve this: The solubility product of CaF2...
Please explain and show all work on how to solve this: The solubility product of CaF2 is 4.0x10^-4. Calc. the molar solubility (s) of calcium Floride in pure water. ksp=(Ca^2+)(F^-)^2 ksp=(s)(2s)^2 =4.0x10^-4 4s^3=4.0x10^-4 s=2.15x10^-4 molar solubility I don't understand how to get s?
Assuming a potential for ‘wobble’, what anticodon(s) in the tRNA would bind to the transcript encoded...
Assuming a potential for ‘wobble’, what anticodon(s) in the tRNA would bind to the transcript encoded by a 5’- TAC -3’ sequence encoded in the DNA? (note that all answers are written in 5’ to 3’ orientation)    a. CAU only    b. CAU and CAI Answer is C c. UAC only    d. UAC or UAU    e. AUG    f. GUA and GUI    g. None of the above
ADVERTISEMENT
Need Online Homework Help?

Get Answers For Free
Most questions answered within 1 hours.

Ask a Question
ADVERTISEMENT